A unified, coordinate-verified catalogue of human PIWI-interacting RNAs (hg38)
Try piRO-hsa-P05240064 piR-hsa-237 TGGAATGAGTTAAGGCTTTAGAGGACC
How each database names a piRNA — search tips (click an example to try)
piRBase · piR-hsa-N piR before the species — e.g. piR-hsa-237. A bare piR-N also works.
piRNAdb · hsa-piR-N stored as piRNAdb-hsa-piR-N; search the bare or full form. Mind hyphens & order.
NCBI (GenBank) · DQ######_piR-N accession + piR number — e.g. DQ569913_piR-30025, or just piR-N.
piRNABank · hsa_piR_NNNNNN underscores, zero-padded — e.g. hsa_piR_000001.
piRNAQuest · hsa_piRNA_N note piRNA (not piR), underscores — e.g. hsa_piRNA_32046.
piOxiDB · hgpiR-N oxidised piRNAs — e.g. hgpiR-0600049.
Also works: the stable accession piRO-hsa-P########, a bare piR-N short name, a gene / TE name, or a nucleotide sequence (≥ 8 nt, A/C/G/T). piRNAclusterDB / proTRAC clusters use IDs like Hsap_N (a genomic cluster, not a single piRNA).
Genome browser SNV explorer Database stats Download
Small non-coding RNA biogenesis
Small non-coding RNA biogenesis overview — nuclear and cytoplasmic pathways: miRNA processing (DROSHA/DICER/AGO), piRNA transposon silencing (PIWI/Aub/Ago3), and tRNA-derived fragments
Small non-coding RNA biogenesis across the nucleus and cytoplasm — miRNA processing (DROSHA / DICER / AGO), piRNA transposon silencing (PIWI / Aub / Ago3), and tRNA-derived fragments. Created with BioRender.
Database overview
Total piRNAs
Families
Accepted loci
Locus SNVs
Known clusters
De-novo clusters
Genome-placed
Family overlaps
1U primary
Data sources
piRBasepiRNAdb piRNABankpiRNAQuest piOxiDBNCBI piRNAclusterDBGENCODE RepeatMaskermiRBase dbSNP · ClinVar · COSMIC · REDIportal